• Register
  • Login
  • Subscribe
  • Contact Us

Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines)

UkraineTenders notice for Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines). The reference ID of the tender is 122738289 and it is closing on 23 Jul 2025.

Tender Details

  • Country: Ukraine
  • Summary: Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines)
  • UAT Ref No: 122738289
  • Deadline: 23 Jul 2025
  • Financier: Self Financed
  • Purchaser Ownership: Government
  • Tender Value: UAH 753200
  • Notice Type: Tender
  • Document Ref. No.: UA-2025-07-15-010690-a
  • Purchaser's Detail:
    Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details. Login to see full purchaser details.
  • Description:
  • Type of purchase: goods
    DK 021: 2015: 33600000-6: Pharmaceutical products
    DNA Polymerase DNA Polymerase, Recombinant (5 U/μL)), 10x500 Units (EP0406), DNA Polymerase DNA Polymerase, Recombinant (5 U/μL)) (EP0402), DNA Polymerase Dreamtaq ™ Hot Start Dna Polymerase, 500 units (EP1702), water, water, water free from nuclease, 100 ml (R 0582), marker DNA gel loading dye (6x), 5x1ml (R0611), marker PUC19 DNA/MSPI (HPAII), 50 μg (SM0221), Agarozh (R) Gram (SM0221) Genomic DNA PURRIFICATION KIT, 100 reactions (K0512), reagent for PCR Dntp Mix (2 MM Each), 1 ml (R0241), Reagent for PCR DNTP MIX (10 MM Each), 1 ml (R0192), Generumer Marker 1 KB DNA LADDER, READY-TO-US, 5x50 NG (SM0313), Etyium Bromide ULTRAPURIPURE ™ Ethid ™ Etidium Ethid ™ Etidium. (15585011), TBE Buffer electrophoresis buffer Methyledge Bisulfite Conversion System, 50 reactions (N1301), methylated control human DNA, 5 mcg control DNA to the previous set (N1231), DNA oligonucleotide synthesis, 25 NMol, Desolted (10629186) F5'GCTGGGGTCCTTGCGCGCGCCATAGT3 '(to detect methylation), DNA synthesis of oligonucleotide, 25 nmol, desolted (10629186) LEP 51NN R5'CGGCCCGATCACAACTTGCGCG3 '(for the detection of methylation), DNA synthesis of oligonucleotides, 25 nmol, desolted (10629186) LEP 31NNTTTCCTCCTCTCTCTCCTCTCCTCCTCCTCCTCCTCCTCCTCCCTCCTCCTCCTCCCTCCTCCCCTCCCCTCCCCTCCCCT. Oligonucleotide DNA Synthesis, 25 NMol, Desolted (10629186) LEP 31NNT R5'CCTGCCCCGC ...
  • Documents:

 Tender Notice

If you are registered member, kindly login to view full details of this tender notice:

CLICK HERE TO LOGIN

Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines) - Ukraine Tender

The STATE INSTITUTION "INSTITUTE OF PROBLEMS OF ENDOCRINE PATHOLOGY, a Government sector organization in Ukraine, has announced a new tender for Dk: 021: 2015 - 33690000-3 Medicines are Different (Medical Products Except Medicines). This tender is published on UkraineTenders under UAT Ref No: 122738289 and is categorized as a Tender. Interested and eligible suppliers are invited to participate by reviewing the tender documents and submitting their bids before the deadline on 2025-07-23.

The estimated tender value is UAH 753200, and full details, including technical specifications and submission requirements, are provided in the official tender documents. Ensure all submissions meet the criteria outlined to be considered for evaluation.

UkraineTenders Features

UkraineTenders Features

Fresh and verified Tenders from Ukraine. Find, search and filter Tenders/Call for bids/RFIs/RFPs/RFQs/Auctions published by the government, public sector undertakings (PSUs) and private entities.

  • 1,000+ Tenders
  • Verified Tenders Only
  • New Tenders Every Day
  • Tenders Result Data
  • Archive & Historical Tenders Access
  • Consultants for RFI/RFP/RFQ
  • Tender Notifications & Alerts
  • Search, Sort, and Filter Tenders
  • Bidding Assistance & Consulting
  • Customer Support
  • Publish your Tenders
  • Export data to Excel
  • API for Tender Data
  • Tender Documents
Tender Experts

Get A Call From Tender Experts

Fill out the form below and you will receive a call from us within 24 hours.

Thank You for Contacting UkraineTenders !!
Email Id is already exist !!
Captcha Image
Invalid Captcha !

Get FREE SAMPLE TENDERS from Ukraine in your email inbox.

  Chat with us